The vector_primer files store the data for each vector/primer pair combination as a single record (line) and up to 100 records can be contained in a file. The items on each line must be separated by spaces or tabs (only the file name can contain spaces) and a newline character ends the record. It is important to realise that the format has been simplified since the first version of the method appeared in release 1999.0 and any files created for the 1999.0 release will need to be edited!
The items in a record are:
name seq_r seq_f file_name
name is an arbitrary record name. seq_r is the sequence between the reverse primer and the cloning site. seq_f is the sequence between the forward primer and the cloning site. file_name is the name of the file containing the complete vector sequence.
An example file containing two entries (for m13mp18, and a vector called f1) is shown below. "\" symbols have been used to denote wrapped lines and so it can be seen that the first record is shown on two lines and the next on 1.
m13mp18 attacgaattcgagctcggtaccc ggggatcctctagagtcgacctgcaggcatgcaagcttggc \ /pubseq/tables/vectors/m13mp18.seq f1 CCGGGAATTCGCGGCCGCGTCGACT CTAGACTCGAGTTATGCATGCA af_clones_vec
Note that the segments of sequence can be longer (or shorter) than the sequences between the primer and the cloning site. The -V option of vector_clip allows the user to specifiy that a fixed number of bases closest to the cloning site be used for any particular run, and so the same record in the vector_primer file could be used for several primers as long as the cloning site was the same. If it is necessary to get the sequence segments precisely defined refer to the figure below. This contains an annotated section of the m13mp18 vector around the SmaI site, to see how it corresponds to the first record in the vector_primer file. The primers shown are the 16mer reverse(-21) and the 17mer forward(-20), and the vector_primer record is the sequence between the primers with a space at the cloning site,
followed by a file name.
SmaI
++++++++10++
--20--------10---------123456789012
r(-21) 432109876543210987654321
aacagctatgaccatg
acacaggaaacagctatgaccatgattacgaattcgagctcggtacccggggatcctcta
6210 6220 6230 6240 6250 6260
++++++20++++++++30++++++++40+
34567890123456789012345678901 f(-20)
tgaccggcagcaaaatg
gagtcgacctgcaggcatgcaagcttggcactggccgtcgttttacaacgtcgtgactgg
6270 6280 6290 6300 6310 6320
There are several consequences of using vector_primer files to specify the sequencing vector details. Please read a description of the vector_primer file algorithm in the algorithms section section Algorithms.
Firstly, to get the vector segments of readings marked correctly it is not necessary to include the relevant data in their experiment files.
Secondly, because vector_clip compares all the primer-vector pairs in the primer_vector file it would be inefficient to include very large numbers of records in these files. Instead it would be better to have a master vector_primer file which contained all the combinations used in the lab and then to copy the relevant ones to project specific files.
Thirdly, even though vector_clip can write the PR record (primer type) into the experiment file if it finds a match, gap4 still needs the template name data in order to do read pair analysis.
Finally note that the -V option for vector_clip means that the segments of sequence in the vector_primer file need not be made exactly the right length when the files are created: it matters only that the cloning site is correctly specified and that there is sufficient length of sequence on either side. For example, vector_primer files could be created in which all records included 40 bases from either side of the cloning sites. The -V option allows the alignment to be limited to the segment of sequence closest to the cloning site. For example, -V 20 specifies that at most 20 bases around the cloning site are used.