This mode of assembly uses the global assembly program FAKII, developed by Myers Eugene W. Myers Jr., Mudita Jain and Susan Larson, University of Arizona, Department of Computer Science.
The FAKII program can be accessed via the Gap4 interface through the "Assembly" menu or as a series of stand alone programs.
The FAKII files for use with Gap4 must be obtained via ftp from the authors Eugene W Myers Jr., Mudita Jain, Eric Anson and Susan Larson at the University of Arizona, Department of Computer Science.
First email a request for authorisation to Dr Gene Myers (gene@cs.arizona.edu) stating you want FAKII for use with Gap4. He will email you a postscript file containing the authorisation document. Print the document. Read it. Sign it, fax it back to Gene Myers at +1 (520) 621-4246 and also post the original signed copy back to Gene.
Then email Susan Larson (susanjo@cs.arizona.edu) requesting a copy of
FAKII for use with Gap4 and she will contact you to arrange for the
transfer. Make sure you tell Susan the operating system for which you
need the program (one of: SunOS 4.1.1; Solaris 2.5; DEC OSF/1 V3.0 and
Digital Unix; Irix 5.3). Make the files Susan sends executable (eg
chmod a+x *) and move them into the directory
$STADENROOT/$MACHINE-bin. The environment variable FAKII must
also be set to $STADENROOT/$MACHINE-bin, for example, for the
bash shell, export FAKII=$STADENROOT/$MACHINE-bin. You could add
this to your staden.profile or staden.login files.
Prior to the files being in this directory the FAKII items on the assembly menu in Gap4 will have been greyed out; now they should appear in normal text and the functions will be selectable.
Assembly using FAKII can be split into either two or three distinct phases. The first phase is that of computing and storing overlaps (graph creation). The second phase is optional and involves the creation of a constraint file. The third phase is the computation and display of the assembly based on the graph and the constraint file if one was created.
The assembly works on a file of reading names in experiment file format (see section Experiment File)
The graph creation phase is modulated by three floating point numbers that control which overlaps are detected and/or accepted as follows:
The "Error limit". The maximum sequencing error rate for which overlaps will be guaranteed to be detected. For example, if this is set to 10%, then the program looks for overlaps with 20% or less differences in the aligned regions. This parameter should never be greater than .2, and we suggest .099 as a standard value.
The "Overlap threshold". The overlap score of an overlap is the log of the a priori odds that such an overlap would occur by chance. Pragmatically, this score is the length of the overlap minus a marginally decreasing penalty per difference. A typical value is 10, implying an overlap of at least 10 bases is needed and that for the overlap to occur by chance is a one in a million (approximately 4^10) event.
The "Distribution limit". It is further required that the distribution of differences along the alignment of an overlap not be highly skewed but spread across the alignment. The distribution score of an alignment is the minimum over all segments of the alignment of the probability that one would see the observed number of differences in that segment given an underlying error process occurring at rate "Error limit". This probability should not be too small, as if it is, it implies there is a segment of the alignment that has an unusually large number of differences in it. Note that this is quite conservative as we are assuming the error process is at the maximum error rate (and not the average error rate). We recommend using a value of .0001 or less.
The "Error limit" and "Distribution limit" parameters control the efficiency with which overlaps are detected. The smaller the error limit or the higher the distribution limit, the less time overlap detection will take. By far the most important of these two efficiency parameters in Version 4.1 is the "Error limit". Note that both are not "thresholds", but only "limits": the graph creation function guarantees to find all overlaps inside the error limit and distribution limit, but may report additional overlaps as well. On the other hand, the overlap threshold is a true threshold: any overlap not scoring above it, i.e., that is not statistically significant enough, will not be entered into the overlap graph.
One should set these three parameters to the most lenient/inclusive values that they think will be ever be needed for proper assembly, moderated by the level of efficiency with which the computation can be done. Philosophically, our view is that overlap detection is a one-time computation in which one determines all the possible ways that the fragments could go together. Later, during assembly, one can select a more stringent subset of the overlaps with which to meld fragments. With regard to efficiency, it should be noted that there are significant changes in performance as "Error limit" crosses the levels .05 and .10. Thus our recommendation is to use .099 as a standard setting.
The graph creation routine creates a binary file in the directory specified in the "Destination directory" entrybox. The name of this file is defined in the .gaprc file.
See section Options Menu. The default name is "graph.bin". In addition, any output from this routine is written to a file "graph_stderr" which is in the destination directory. This information is also displayed in the text output window. The graph binary file may be used as input to the standalone programs, "show_graph" and "assemble".
The FAKII assembly program supports the use of a constraints file. This file is generated automatically by setting the "Use constraint file" radiobutton to "Yes". A binary and ascii version of this file are written to the destination directory. The names of these files can be specified in the .gaprc file and their default values are "constraint.bin" and "constraint.ascii". The binary version of the constraints file may be used with the "assemble" stand alone program via the "-c" option.
Readings which are on the same template are constrained by both distance and orientation. The template name is defined in the experiment file by the TN line (see section Experiment File) If this does not exist, the EN or alternatively the ID line is used. If none of these have been defined, the template is deemed to be "unknown". The orientation is determined from the primer information (PR). If no PR line is defined, the primer type is guessed from the strand (ST) information. The template length is given as a range in the SI line. Forward and reverse primer readings must lie at the beginning and end of the template respectively and therefore must be separated by the template length. Custom primers may lie anywhere on the template.
The final phase is that of assembly which is based on the graph and the constraints file, if one was created. Several alternative assemblies may be produced from a single set of input parameters. These different assemblies may be distinguished by setting the "Assembly number". Setting this to 1 will produce the best assembly. Setting it to 2, will produce the 2nd best assembly, etc.
The assembly takes place over a subset of the edges in the overlap graph determined by three floating point parameters as follows:
The "Error rate". The distribution score of each edge in the overlap graph will be computed assuming an error process at the specified rate. Edges will then be eliminated if their distribution score/probability is below "Distribution threshold".
The "Overlap threshold". Specifies the minimum overlap score for edges to be considered in assemblies. Setting this paramenter to 0. guarantees that no edges are eliminated on this basis.
The "Distribution threshold". Specifies the minimum error distribution score for edges to be considered in assemblies. Any edge in the overlap graph whose distribution score with respect to error rate "Error rate" is less than "Distribution threshold" is eliminated from consideration as regards melding fragments. Setting this parameter to 1.0 eliminates all edges, and setting it to 0.0 eliminates none.
The destination directory defines where the output files will be written. If the directory does not already exist, it is created.
The assembly routine creates a binary file "assem.bin" in the destination directory. In addition, any output from this routine is written to a file "assemble_stderr" also in the destination directory. The assembly binary file may be used as input to the "show_layout", "show_multi" and "write_exp_file" stand alone programs.
It is possible to view the final assembly in two ways using the "Show layout" and "Show multi-alignment" check buttons.
Show layout produces a "stick diagram" of an assembly in which the arrangement of fragments in each contig of an assembly is shown by depicting each fragment as a line with an arrowhead at one end or the other to indicate its orientation. (Details as for the show_layout command)
*** CONTIG 1 (Score = 3480.32):
0.2K 0.4K 0.6K 0.8K 1.0K
| | | | |
1: ---------> ---------------------> <----------.
2: <----------------- <--------------------+-------.
3: <-------------- <--------------------- <-----.
4: <---------- ------------------->-------.
5: ---------------> -----.
6: ------------->
7: ---------------->
8: <----------------
1: xb54f3.s1: 1 xb66a6.s1: 322 xb60c11.s1: 793
2: xb66e3.r1: 38 xb60e9.s1: 435 xb63f10.s1: 852
3: xb57h12.s1: 72 xc04a1.r1: 435 xb66f8.s1: 884
4: xb61e3.s1: 85 xb64b3.s1: 470 xb56b6.s1: 874
5: xb54b12.s1: 463 xb58f4.s1: 919
6: xb64a1.s1: 600
7: xb66a5.s1: 481
8: xb60f4.s1: 622
1: .----
2: .---->
3: .-----
4: .-------->
5: .---->
6: ----->
1: xb60c11.s1: 793
2: xb63f10.s1: 852
3: xb66f8.s1: 884
4: xb56b6.s1: 874
5: xb58f4.s1: 919
6: xb62d10.s1:1007
Show multi-alignment prints a multi-alignment of each contig of an assembly along with the consensus sequence. (Details as for the show_multi command).
*** CONTIG 1 (Score = 3480.32):
xb54f3.s1>: CTNTNAAAAGGCGTTGGATTNGTACGTTTCGACAAAAAAGACGAAGCTGA
xb66e3.r1<: AAGACGAAGCTGA
--------------------------------------------------
CTnTnAAAAGGCGTTGGATTnGTACGTTTCGACAAAAAAGACGAAGCTGA
xb54f3.s1>: GTGTTGCAATTAAAACACTAAATGGAAGTATTCCATCAGGATGTTCAGAG
xb66e3.r1<: -TGTTGCAATTAAAACACTAAATGGAAGTATTCCATCAGGATGTTCAGAG
xb57h12.s1<: ATGGAAGTATTCCATCAGGATGTTCAGAG
xb61e3.s1<: ATCAGGATGTTCAGAG
--------------------------------------------------
gTGTTGCAATTAAAACACTAAATGGAAGTATTCCATCAGGATGTTCAGAG
xb54f3.s1>: CAAATCACAGTGAAATTCGCAAATAATCCAGCAAGTAACAATCCGAAAGG
xb66e3.r1<: CAAATCACAGTGAAATTCGCAAATAATCCAGCAAGTAACAATCCGAAAGG
xb57h12.s1<: CAAATCACAGTGAAATTCGCAAATAATCCAGCAAGTAACAATCCGAAAGG
xb61e3.s1<: CAAATCACAGTGAAATTCGCAAATAATCCAGCAAGTAACAATCCGAAAGG
--------------------------------------------------
CAAATCACAGTGAAATTCGCAAATAATCCAGCAAGTAACAATCCGAAAGG
This mode imports the aligned sequences produced after FAKII assembly into Gap4 and maintains the same alignment. It takes data from the directory containing the assembly binary file (default name "assem.bin"), ie the destination directory used in "Perform FAKII assembly". A single contig may be entered, all the contigs or a file or list of contig numbers. Note that the contig numbers are those defined by FAKII and not by Gap4. The assembly information for each reading is extracted from the assembly binary file and new experiment files are created in the same directory as assembly binary file (ie that defined in "Directory containing assembly"). If the original experiment files are accessible (ie in the directory in which the Gap4 program is being run), the new experiment files will incorporate information from the original experiment files. If the original files are not available, the new experiment files produced will contain only limited information. Once the new experiment files have been created, these are read into Gap4 in a manner which is functionally equivalent to "Directed assembly". See section Directed Assembly. Readings from the selected contigs which are not entered are written to a "list" or "file" specified in the "Save failures" entry box.
This mode performs both the assembly section Perform FAKII assembly and the import section Import FAKII assembly routines together. The assembled readings are written to the destination directory and then are automatically imported from this directory into the Gap4 database.